View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0150_low_1 (Length: 402)
Name: NF0150_low_1
Description: NF0150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0150_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 58 - 274
Target Start/End: Complemental strand, 42290223 - 42289994
Alignment:
Q |
58 |
gtccaaacaaaatatatagaatatgttatgtcaaaaaatacttgtctcat-------------attcgtactaaattgagaaatatatattcattttata |
144 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
T |
42290223 |
gtccaaactaaatatatagaatatgttatgtcaaaaaatacttgtctcattatgtattatttcattcgtactaaattgagaaatatatattaattttata |
42290124 |
T |
 |
Q |
145 |
tgaaaacgaaaaagtatgaactactttttacaaaaccgtattttatcatttgtacgaaaaatacattttaatagaaatacttgacatctaaaatgaatgt |
244 |
Q |
|
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
42290123 |
tgaaaacgaaaaattatgaactactttttacaaaactgtattttatcatttgtacgaaaaatacattttaatagaaatacttgacatctaaagtgaatgt |
42290024 |
T |
 |
Q |
245 |
gaaactagtttatactggcaagtaaatgtc |
274 |
Q |
|
|
||||||||||||| |||||||||||||||| |
|
|
T |
42290023 |
gaaactagtttatcctggcaagtaaatgtc |
42289994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 42289956 - 42289889
Alignment:
Q |
311 |
ctattgcggtataaaaagggtaaaacttgattgattatatcatcactatatagataatttgatgatgt |
378 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
42289956 |
ctattgcggtataaaaagggtaaaacttgattgattatatcatcattatatagataatttgatgatgt |
42289889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 723 times since January 2019
Visitors: 2236