View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151-INSERTION9 (Length: 539)
Name: NF0151-INSERTION9
Description: NF0151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151-INSERTION9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 193
Target Start/End: Original strand, 41277641 - 41277829
Alignment:
| Q |
5 |
acaaatgagtccatcaatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277641 |
acaaatgagtccatcaatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttca |
41277740 |
T |
|
| Q |
105 |
attctgcggcgtttgtttatctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacata |
193 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277741 |
attctgcggcgtttgtttctctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacata |
41277829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 175; E-Value: 6e-94
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 41277879 - 41278061
Alignment:
| Q |
243 |
ccggagtggccgtttagtactaaattgatgaatctgggatctgctccggcgtccatgagttgttctcgggtgggaattgcgctttcgtcgaagttgcgga |
342 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277879 |
ccggagtggccgtttaggactaaattaatgaatctgggatctgctccggcgtccatgagttgttctcgggtgggaattgcgctttcgtcgaagttgcgga |
41277978 |
T |
|
| Q |
343 |
actcaacgggaatgtcgtcgtcgaagggaaaatcgttgaacggaaaatccattacggtgaattcgtccgagaaaacatgtgac |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277979 |
actcaacgggaatgtcgtcgtcgaagggaaaatcgttgaacggaaaatccattacggtgaattcgtccgagaaaacatgtgac |
41278061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 489 - 539
Target Start/End: Original strand, 41278128 - 41278177
Alignment:
| Q |
489 |
ggggtagacgtttgaatgtagcgaggggaaacctggaaggcgcggaaacgg |
539 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41278128 |
ggggtagacgtttgaatgtagcgaggggaaacct-gaaggcgcggaaacgg |
41278177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 492 times since January 2019
Visitors: 2226