View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_high_10 (Length: 393)
Name: NF0151_1D_high_10
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0151_1D_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 22 - 136
Target Start/End: Complemental strand, 43590486 - 43590371
Alignment:
Q |
22 |
aaggaccccatgtaaggtcgtggagatatgtttcaagaatgcaattgg-agattagatcacaggctaggatcatacgtgggagcaccaaatgaaacttca |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43590486 |
aaggaccccatgtaaggtcgtggagatatgtttcaagaatgcaattgggagattagatcacaggctaggatcatacgtgggagcaccaaatgaaacttca |
43590387 |
T |
 |
Q |
121 |
tcgcactgctacgata |
136 |
Q |
|
|
|| ||||||||||||| |
|
|
T |
43590386 |
tcacactgctacgata |
43590371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 201 - 377
Target Start/End: Complemental strand, 43590306 - 43590140
Alignment:
Q |
201 |
ctgttgtacgagattgaatgtaatattgtaatttgttggttgatcagtgaaacatggatatgatttggcatttgagcctnnnnnnnnnnnnnnnnnnnnn |
300 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43590306 |
ctgttgtatgagattgaatgtaatattgtaatttgttggttgatcagtgaaacatggatatgatttggcatttgagcct----------tctctctctct |
43590217 |
T |
 |
Q |
301 |
ngtatgcttggttttagttgagaatgtatatataccattagacagtcctctcatgtacatgccatgctgtaagtgtc |
377 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43590216 |
cgtatgcttggttatagttgagaatgtatatataccattagacagtcctctcatgtacatgccatgctgtaagtgtc |
43590140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University