View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_high_19 (Length: 318)
Name: NF0151_1D_high_19
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0151_1D_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 6 - 315
Target Start/End: Complemental strand, 3740070 - 3739761
Alignment:
Q |
6 |
agctagctaactttaatgttccacatcttccaagcaaaatcaaaaggcatcacaactcaataaattcaaatttgtttgcttttgtaaaagtccagatact |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3740070 |
agctagctaactttaatgttccacatcttccaagcaaaatcaaaaggcatcacaactcaataaattcaaatttgtttgcttttgtaaaagtccagatact |
3739971 |
T |
 |
Q |
106 |
tgtatctttgatcctgcataagctgtacttctcatgtgattctgatcttagttgttatggtagggacaaaataaaattgtcatggaagaattttgaaaag |
205 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
3739970 |
tgtatctttgatcctccataagctgtacttctcatgtgattctgatcttagttgttatggtagggacaaaataaaattgtcatggaagaatcttgaaaag |
3739871 |
T |
 |
Q |
206 |
aatgtctcaattttgcttaaattaagggatactcttttcaggtcacaagaattctattttatacggttgtacactctttacttctattaatatatgactt |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3739870 |
aatgtctcaattttgcttaaattaagggatactcttttcaggtcacaagaattctattttatacggttgtacactctttacttctattaatatatgactt |
3739771 |
T |
 |
Q |
306 |
ttcttttctg |
315 |
Q |
|
|
|||||||||| |
|
|
T |
3739770 |
ttcttttctg |
3739761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1171 times since January 2019
Visitors: 1527