View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_high_26 (Length: 260)
Name: NF0151_1D_high_26
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0151_1D_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 106 - 227
Target Start/End: Complemental strand, 24416666 - 24416545
Alignment:
Q |
106 |
aaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctgattgtgtttgt |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24416666 |
aaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctgattgtgtttgt |
24416567 |
T |
 |
Q |
206 |
ggtagagactagggttgctgtt |
227 |
Q |
|
|
||||||||| |||||||||||| |
|
|
T |
24416566 |
ggtagagacaagggttgctgtt |
24416545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 29148580 - 29148519
Alignment:
Q |
161 |
tgaatgtaaatgaaataataaaataattgtgctgattgtgtttgtggtagagactagggttg |
222 |
Q |
|
|
|||||| |||||||||||||| ||||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
29148580 |
tgaatggaaatgaaataataacataattgtgctgattgtgtctgtggtagagacaagggttg |
29148519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 106 - 194
Target Start/End: Complemental strand, 29151617 - 29151529
Alignment:
Q |
106 |
aaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctg |
194 |
Q |
|
|
|||||||| || |||||| ||||||| |||||||| |||||||||| || ||| | |||| |||||||||||||| ||| |||||||| |
|
|
T |
29151617 |
aaatgttagctaaatgattgaaatcatggttaggggtatggaaaatgcaaaggaataaatggaaatgaaataataacatagttgtgctg |
29151529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 227 - 260
Target Start/End: Complemental strand, 24416530 - 24416497
Alignment:
Q |
227 |
ttagggtgctgaatgacagacttttataaattgg |
260 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |
|
|
T |
24416530 |
ttagggtgctgcatgacagacttttataaattgg |
24416497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University