View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_34 (Length: 272)
Name: NF0151_1D_low_34
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151_1D_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 252
Target Start/End: Complemental strand, 47956498 - 47956265
Alignment:
| Q |
20 |
ctttgaatgtaataatcttattataattatcaagcacaatcagtcagggataatgattggccgatgtcttcatttattctcttttt-ctgtcacttgtca |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47956498 |
ctttgaatgtaacaatcttattataattatcaagcacaatcagtcagggataatgattggccgatgtcttcatttattctcttttttctgtcacttgtca |
47956399 |
T |
 |
| Q |
119 |
gtccccaacctcattcctttccgtacgtatagtgaattgtaaagaacaatgtcaaggttcatacacgatcttttttaaacatagccgagtttgctaacta |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47956398 |
gtccccaacctcattcctttctgtacgtatagtgaattgtaaagaacaatgtcaaggttcatacacgatcttttttaaacatagccgagtttgctaacta |
47956299 |
T |
 |
| Q |
219 |
cacaagacagtaactcaatataaccaacacttga |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47956298 |
cacaagacagtaactcaatataaccaacacttga |
47956265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University