View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_35 (Length: 270)
Name: NF0151_1D_low_35
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151_1D_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 21 - 255
Target Start/End: Original strand, 23333613 - 23333847
Alignment:
| Q |
21 |
tcaagctctgcataatatgtattcagcaatcgcatctcttgaagggaaagctcatcagcaacacgaacaacagttcctgaggtaacgacaatgtgtacat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23333613 |
tcaagctctgcataatatgtattcagcaatcgcatctcttgaagggaaagctcatcagcaacacgaacaacagttcctgaggcaacgacaatgtgtacat |
23333712 |
T |
 |
| Q |
121 |
ttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattacataaaacaaacttatcaacctctttgggggagtactgcttcagctgcattct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23333713 |
ttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattacataaaacaaacttatcaacctcttggggggagtactgcttcagctgcattcc |
23333812 |
T |
 |
| Q |
221 |
ggcacacaattttatcggtcaacttcgtgatgtcc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
23333813 |
ggcacacaattttatcggtcaacttcgttatgtcc |
23333847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University