View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_36 (Length: 269)
Name: NF0151_1D_low_36
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0151_1D_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 108 - 236
Target Start/End: Complemental strand, 24416673 - 24416545
Alignment:
Q |
108 |
tttcttaaaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctgattg |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24416673 |
tttcttaaaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctgattg |
24416574 |
T |
 |
Q |
208 |
tgtttgtggtagagactagggttgctgtt |
236 |
Q |
|
|
|||||||||||||||| |||||||||||| |
|
|
T |
24416573 |
tgtttgtggtagagacaagggttgctgtt |
24416545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 29148580 - 29148519
Alignment:
Q |
170 |
tgaatgtaaatgaaataataaaataattgtgctgattgtgtttgtggtagagactagggttg |
231 |
Q |
|
|
|||||| |||||||||||||| ||||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
29148580 |
tgaatggaaatgaaataataacataattgtgctgattgtgtctgtggtagagacaagggttg |
29148519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 203
Target Start/End: Complemental strand, 29151624 - 29151529
Alignment:
Q |
108 |
tttcttaaaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctg |
203 |
Q |
|
|
||||||||||||||| || |||||| ||||||| |||||||| |||||||||| || ||| | |||| |||||||||||||| ||| |||||||| |
|
|
T |
29151624 |
tttcttaaaatgttagctaaatgattgaaatcatggttaggggtatggaaaatgcaaaggaataaatggaaatgaaataataacatagttgtgctg |
29151529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 111
Target Start/End: Complemental strand, 24416733 - 24416703
Alignment:
Q |
81 |
acaattttaggttctatttgtttcttctttc |
111 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
24416733 |
acaattttaggttctatttgtttcttctttc |
24416703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 236 - 269
Target Start/End: Complemental strand, 24416530 - 24416497
Alignment:
Q |
236 |
ttagggtgctgaatgacagacttttataaattgg |
269 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |
|
|
T |
24416530 |
ttagggtgctgcatgacagacttttataaattgg |
24416497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 11 - 87
Target Start/End: Original strand, 2517999 - 2518075
Alignment:
Q |
11 |
ccacaactttagacacaccacagccagctattggctgcaattatgcaaaaatcatcggtagctacacgacacaattt |
87 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2517999 |
ccacaactttagacacaccacagccagcaattggctgcaattatgcaaaaatcatcggtagctacacgacacaattt |
2518075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University