View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0151_1D_low_38 (Length: 260)

Name: NF0151_1D_low_38
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0151_1D_low_38
NF0151_1D_low_38
[»] chr6 (4 HSPs)
chr6 (106-227)||(24416545-24416666)
chr6 (161-222)||(29148519-29148580)
chr6 (106-194)||(29151529-29151617)
chr6 (227-260)||(24416497-24416530)


Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 106 - 227
Target Start/End: Complemental strand, 24416666 - 24416545
Alignment:
106 aaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctgattgtgtttgt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24416666 aaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctgattgtgtttgt 24416567  T
206 ggtagagactagggttgctgtt 227  Q
    ||||||||| ||||||||||||    
24416566 ggtagagacaagggttgctgtt 24416545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 29148580 - 29148519
Alignment:
161 tgaatgtaaatgaaataataaaataattgtgctgattgtgtttgtggtagagactagggttg 222  Q
    |||||| |||||||||||||| ||||||||||||||||||| |||||||||||| |||||||    
29148580 tgaatggaaatgaaataataacataattgtgctgattgtgtctgtggtagagacaagggttg 29148519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 106 - 194
Target Start/End: Complemental strand, 29151617 - 29151529
Alignment:
106 aaatgttatcttaatgataaaaatcattgttaggggcatggaaaatgtaagggagtgaatgtaaatgaaataataaaataattgtgctg 194  Q
    |||||||| || ||||||  ||||||| |||||||| |||||||||| || ||| | |||| |||||||||||||| ||| ||||||||    
29151617 aaatgttagctaaatgattgaaatcatggttaggggtatggaaaatgcaaaggaataaatggaaatgaaataataacatagttgtgctg 29151529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 227 - 260
Target Start/End: Complemental strand, 24416530 - 24416497
Alignment:
227 ttagggtgctgaatgacagacttttataaattgg 260  Q
    ||||||||||| ||||||||||||||||||||||    
24416530 ttagggtgctgcatgacagacttttataaattgg 24416497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University