View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_43 (Length: 241)
Name: NF0151_1D_low_43
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151_1D_low_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 50 - 203
Target Start/End: Complemental strand, 24414321 - 24414168
Alignment:
| Q |
50 |
attattagttgatttgagataaatcagtcccgtcttttatcctattgtgaaggagcgtatttcttaaatcctattgaagttattggtgaataggcaagaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24414321 |
attattagttgatttgagataaatcagtcccgtcttttatcctattgtgaaggaacatatttcttaaatcctattgaagttattggtgaataggcaagaa |
24414222 |
T |
|
| Q |
150 |
ctgatttccagacctatatgtcttcatttgcttatttgattgtttttcttcatt |
203 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24414221 |
ccaatttccagacctatatgtcttcatttgcttatttgattgtttttcttcatt |
24414168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 203
Target Start/End: Complemental strand, 19024446 - 19024371
Alignment:
| Q |
128 |
gttattggtgaataggcaagaactgatttccagacctatatgtcttcatttgcttatttgattgtttttcttcatt |
203 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19024446 |
gttattggtgaataggaaagaataaatttccagacctatatgtcttcatttgcttatttgattgtttttcttcatt |
19024371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 53
Target Start/End: Original strand, 48011384 - 48011422
Alignment:
| Q |
15 |
atgaggcagagaatatgacatgggaatcaaagtacatta |
53 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
48011384 |
atgaggcagagcatgtgacatgggaatcaaagtacatta |
48011422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1158 times since January 2019
Visitors: 1527