View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_44 (Length: 240)
Name: NF0151_1D_low_44
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151_1D_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 52028989 - 52028757
Alignment:
| Q |
1 |
gttatttgaacttcatatatattgaagtatactgactgcaggctacagccctcttgtaattttggaattgctttgccaattttcataattcagtgtctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52028989 |
gttatttgaacttcatatatattgaagtatactgactgcaggctacagccctcttgtaattttggaattgctttgccaattttcataattcagtgtctat |
52028890 |
T |
|
| Q |
101 |
caagactcgagcaagtatttttgtgaagcatctttttcatttgttctaggtgggggaactaataatagccaatgagttatcattatatcatgagtatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52028889 |
caagactcgagcaagtatttttgtgaagcatctttttcatttgttctaggtgggggaactaataatagccaatgagttatcattatatcatgagtatata |
52028790 |
T |
|
| Q |
201 |
atgctattcaatactagtttctcagtataattt |
233 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
52028789 |
atgctattcaatactagtttctcagtaaaattt |
52028757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1162 times since January 2019
Visitors: 1527