View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_45 (Length: 237)
Name: NF0151_1D_low_45
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0151_1D_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 10 - 231
Target Start/End: Original strand, 44082761 - 44082983
Alignment:
Q |
10 |
gaaaagtgcattatttgatgtacaaaataaatagttcaaatggggaaattgggcttggttgtcttcaactatatctgtgtaatttttaaaattaaaagaa |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44082761 |
gaaaagtgcattatttgatgtacaaaataaatagttcaaatggggaaattgggcttggttgtcttcaactatatctgtgtaatttttaaaattaaaagaa |
44082860 |
T |
 |
Q |
110 |
taacccttagatcaacttgaagaagcaaagtaattaataagataataacaactaaggaatattgttcaaatgaaaagt-nnnnnnnnnngtatgaataag |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
44082861 |
taacccttagatcaacttgaagaagcaaagtaattaataagataataacaactaaggaatattgttcaaatgaaaagtaaaaaaaaaaagtatgaataag |
44082960 |
T |
 |
Q |
209 |
aaggaagatgtgacataacacaa |
231 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
44082961 |
aaggaagatgtgacataacacaa |
44082983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1186 times since January 2019
Visitors: 1528