View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_48 (Length: 224)
Name: NF0151_1D_low_48
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151_1D_low_48 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 224
Target Start/End: Original strand, 38936003 - 38936220
Alignment:
| Q |
7 |
gtgtttggtagcaatctcaacgccgaaacggaacaaggcgaaactggttcatctcggagcagtgaaggtcttctcgaaccttctaatcgcgtcacatagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
38936003 |
gtgtttggtagcaatctcaacgccgaaacggaacaaggcgaaactggttcatctcggagcagtgaaggtcttctcgaaccttctaaccgcgtcacctagt |
38936102 |
T |
|
| Q |
107 |
ttgtgtgtttctgtgacggagaaggtgttgaaacttctagaaactgtgtcgtcgacgaaggaggggaggtcggagatatgtgaagcgccgtcgtgtgtgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38936103 |
ttgtgtgtttctgtgacggagaaggtgttgaaacttctagaaacggtgtcgtcgacgaaggaggggaggtcggagatatgtgaagcgccgtcgtgtgtgg |
38936202 |
T |
|
| Q |
207 |
cggcgatagtgaacaaag |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38936203 |
tggcgatagtgaacaaag |
38936220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1136 times since January 2019
Visitors: 1526