View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_50 (Length: 213)
Name: NF0151_1D_low_50
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151_1D_low_50 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 23 - 213
Target Start/End: Original strand, 32829278 - 32829469
Alignment:
| Q |
23 |
taagggacgaatttggcgcttggatt-gtggtgtggcttggagtatgggttgctgcttggtcctattgactgagatttggggtatcctaactattcttca |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32829278 |
taagggacgaatttggcgcttggatttgtggtgtggcttggagtatgggttgctgcttggtcctattgactgagatttagggtatcctaactattcttca |
32829377 |
T |
 |
| Q |
122 |
aaaattggttgggagaaagattacaaatttgtttcgattgagtcggattcggcactagtaatttcgctacgaacaatgtgtgtcatcctcct |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32829378 |
aaaattggttgggaaaaagattacaaatttgtttcgattgagtcggattcggcaccagtaatttcgctacgaacaatgtgtatcatcctcct |
32829469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University