View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0151_1D_low_57 (Length: 202)
Name: NF0151_1D_low_57
Description: NF0151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0151_1D_low_57 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0212 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 14030 - 13845
Alignment:
| Q |
1 |
tcaatggtatcggacttatgagtattcagactataacagttccgatgaacagtcactcacttttgacagttatacgattccggaagatgatctagaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14030 |
tcaatggtatcggacttatgagtattcagactataacagttccgatgaacagtcactcacttttgacagttatacgattccggaagatgatctagaattg |
13931 |
T |
|
| Q |
101 |
ggtcaatcacgtttattagaagtggacaatagagtggttgtaccagccaaaactcatctacgtattattgtaacatctgctgatgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13930 |
ggtcaatcacgtttattagaagtggacaatagagtggttgtaccagccaaaactcatctacgtattattgtaacatctgctgatgt |
13845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 53 - 186
Target Start/End: Original strand, 1677528 - 1677661
Alignment:
| Q |
53 |
tcactcacttttgacagttatacgattccggaagatgatctagaattgggtcaatcacgtttattagaagtggacaatagagtggttgtaccagccaaaa |
152 |
Q |
| |
|
|||||||||||||| | |||||||||| |||| |||||||| |||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1677528 |
tcactcacttttgaaacttatacgattttggaaaatgatctataattaggtcaatcatgtttattagaattggacaatagagtgattgtaccagccaaaa |
1677627 |
T |
|
| Q |
153 |
ctcatctacgtattattgtaacatctgctgatgt |
186 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| |
|
|
| T |
1677628 |
ctcatctacgtattattgtaacatttgttgatgt |
1677661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 34584483 - 34584443
Alignment:
| Q |
1 |
tcaatggtatcggacttatgagtattcagactataacagtt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34584483 |
tcaatggtatcggacttatgagtattcagactataacagtt |
34584443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1146 times since January 2019
Visitors: 1526