View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0152-INSERTION10 (Length: 273)
Name: NF0152-INSERTION10
Description: NF0152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0152-INSERTION10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 22 - 273
Target Start/End: Complemental strand, 38279012 - 38278761
Alignment:
| Q |
22 |
actcgatatatagataaaatgtgacactttagcctttgcattcccctgcatcgaatatatctataactggcttgttatttgatcagttccaacctgtcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38279012 |
actcgatatatagataaaatgtgacactttagcctttgcatttccctgcatcgaatatatctataactggcttgttatttgatcagttccaacctgtcaa |
38278913 |
T |
 |
| Q |
122 |
gtctcaccctaacaggattatgaggagaaaatatcagaaccgatcataagagagaagctatcaaacaggcttgtgacacatggaacattttgaaggtacg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38278912 |
gtctcaccctaacaggattatgaggagaaaatatcagaaccgatcataagagagaagctatcaaacaggcttgtgacacatggaacattttgaaggtacg |
38278813 |
T |
 |
| Q |
222 |
tatatgatacatccaccgtgtatatatgtactaaaaatatacattgaaccgg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38278812 |
tatatgatacatccaccgtgtatatatgtactaaaaatatacattgaaccgg |
38278761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University