View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0152-INSERTION11 (Length: 230)
Name: NF0152-INSERTION11
Description: NF0152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0152-INSERTION11 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 21468403 - 21468625
Alignment:
Q |
8 |
cttcttatgtatgattacatgccaaatgggagtcttggaagtttacttcatgaaggaagtggtaattgcttggagtggcacattcgattcaagataatac |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||| ||||||||||||||| |
|
|
T |
21468403 |
cttcttatgtatgattacatgccaaatgggagtcttggaagtttacttcatgaaggaagcggtaattgcttggaatggcatattagattcaagataatac |
21468502 |
T |
 |
Q |
108 |
taggagcagctcaaggtgtggcttatttacaccatgactgtgctcctcctattgttcacagagatattaaggccaacaacatcctcataggtcttgaatt |
207 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21468503 |
taggagcagctcaaggcgtggcttatttacaccatgattgtgctcctcctattgttcacagagatattaaggccaacaacatcctcataggtcttgaatt |
21468602 |
T |
 |
Q |
208 |
tgaaccatacataactgattttg |
230 |
Q |
|
|
||||||||||||| ||||||||| |
|
|
T |
21468603 |
tgaaccatacatagctgattttg |
21468625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 135 - 230
Target Start/End: Original strand, 20132513 - 20132608
Alignment:
Q |
135 |
tacaccatgactgtgctcctcctattgttcacagagatattaaggccaacaacatcctcataggtcttgaatttgaaccatacataactgattttg |
230 |
Q |
|
|
|||| |||||||||| ||||||||| || |||||||||||||| ||||| |||||| | || || |||||||||||||| || || ||||||||| |
|
|
T |
20132513 |
tacatcatgactgtgttcctcctatagtccacagagatattaaagccaataacatcttgattggacttgaatttgaaccttatattgctgattttg |
20132608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 530 times since January 2019
Visitors: 2229