View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0152-INSERTION13 (Length: 219)
Name: NF0152-INSERTION13
Description: NF0152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0152-INSERTION13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 8 - 219
Target Start/End: Complemental strand, 35117353 - 35117145
Alignment:
| Q |
8 |
taaacattatcgtatcttcgttatttcaatagcaaaacgcataaatttactgttttttgttaccatttcatcaaatgttatctgtttcatttcattcatc |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35117353 |
taaacattattgtatcttcgttatttcaatagcaaaacgcataaatttactgttttttgttaccatttcatcaaatgttatctgtttcatttcattcatc |
35117254 |
T |
 |
| Q |
108 |
aatgtctttgttatgttatataaagcataaaatgaattatagttatccaaaaatacaannnnnnnnncttttcgccttctccttgttggatctgtggtgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35117253 |
aatgtctttgttatgttatataaagcataaaatgaattatagttatccaaaaatacaaatttttt---ttttcgccttctccttgttggatctgtggtgg |
35117157 |
T |
 |
| Q |
208 |
gttttgtttatt |
219 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35117156 |
gttttgtttatt |
35117145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University