View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0152-INSERTION14 (Length: 263)
Name: NF0152-INSERTION14
Description: NF0152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0152-INSERTION14 |
 | |
|
| [»] chr4 (5 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 42768143 - 42767891
Alignment:
| Q |
11 |
ataactttatacaatcttaattttaattttaatctttataatactaaaacaaattcaaatattttgcagcgagaataaaagataatacaggaaagcctat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42768143 |
ataactttatacaatcttaattttaattttaatctttataatactaaaacaaattcaaatattttgcagcgagaataaaagataatacaggaaagcctat |
42768044 |
T |
|
| Q |
111 |
attggattcaacacgcataaacgcaaatccatttgcatatggtgcggggcacgtccaacctaatcatgccgtggaccctggacttgtttatgacctaaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42768043 |
attggattcaacacgcataaacgcaaatccatttgcatatggtgcggggcaagtccaacctaatcatgccgtggaccctggacttgtttatgacctaaat |
42767944 |
T |
|
| Q |
211 |
atcaccgactatacgaactatttgtgcaaccgtggctacaaaggttctcgcct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42767943 |
atcaccgactatacgaactatttgtgcaaccgtggctacaaaggttctcgcct |
42767891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 251
Target Start/End: Complemental strand, 42715314 - 42715229
Alignment:
| Q |
166 |
caacctaatcatgccgtggaccctggacttgtttatgacctaaatatcaccgactatacgaactatttgtgcaaccgtggctacaa |
251 |
Q |
| |
|
|||||||||| || || |||||||||||||| |||||||||||||| || ||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
42715314 |
caacctaatcgtgtggtcgaccctggacttgtatatgacctaaatattactgactatatgaactttttgtgcgctcgtggctacaa |
42715229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 212
Target Start/End: Complemental strand, 42742253 - 42742185
Alignment:
| Q |
144 |
tgcatatggtgcggggcacgtccaacctaatcatgccgtggaccctggacttgtttatgacctaaatat |
212 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||| || || |||||||| |||||||||||||| |
|
|
| T |
42742253 |
tgcatatggtgcagggcacgttcgacctaatcttgccgcagatcccggacttgtgtatgacctaaatat |
42742185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 212
Target Start/End: Complemental strand, 42751612 - 42751544
Alignment:
| Q |
144 |
tgcatatggtgcggggcacgtccaacctaatcatgccgtggaccctggacttgtttatgacctaaatat |
212 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||| | || ||||||||||| |||||||||||||| |
|
|
| T |
42751612 |
tgcatatggtgcagggcacgttcgacctaatcttgcagcagatcctggacttgtgtatgacctaaatat |
42751544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 212
Target Start/End: Complemental strand, 42761074 - 42761006
Alignment:
| Q |
144 |
tgcatatggtgcggggcacgtccaacctaatcatgccgtggaccctggacttgtttatgacctaaatat |
212 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||| | || ||||||||||| |||||||||||||| |
|
|
| T |
42761074 |
tgcatatggtgcagggcacgttcgacctaatcttgcagcagatcctggacttgtgtatgacctaaatat |
42761006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 212
Target Start/End: Original strand, 23042246 - 23042314
Alignment:
| Q |
144 |
tgcatatggtgcggggcacgtccaacctaatcatgccgtggaccctggacttgtttatgacctaaatat |
212 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||| | || ||||||||||| |||||||||||||| |
|
|
| T |
23042246 |
tgcatatggtgcagggcacgttcgacctaatcttgcagcagatcctggacttgtgtatgacctaaatat |
23042314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 212
Target Start/End: Original strand, 42315647 - 42315726
Alignment:
| Q |
133 |
gcaaatccatttgcatatggtgcggggcacgtccaacctaatcatgccgtggaccctggacttgtttatgacctaaatat |
212 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||| |||||||||| ||| | ||||||||||| ||||||| || ||||| |
|
|
| T |
42315647 |
gcaactccatttgcatatggttcgggtcacgttcaacctaatcttgctatagaccctggactaatttatgatcttaatat |
42315726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 610 times since January 2019
Visitors: 2233