View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0152-INSERTION5 (Length: 420)
Name: NF0152-INSERTION5
Description: NF0152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0152-INSERTION5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 30742445 - 30742518
Alignment:
| Q |
32 |
gcattcccttgtatgcagaaaactatgcttatcttttgggtcattttgatgcatcttcaattagctaacttaat |
105 |
Q |
| |
|
|||||| || |||| || ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30742445 |
gcattcactagtattcaaaaagctatgcttatcttttgggtcattttgatgcatcttcaatcagctaacttaat |
30742518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 227
Target Start/End: Original strand, 30742749 - 30742829
Alignment:
| Q |
151 |
ggtatgcttttgaaagaaagaaaccaccaaat-aagtgagatgat---taaagatgctaataagctgccaactcaaacaat |
227 |
Q |
| |
|
|||||||||||| || |||| | ||||||||| |||||| ||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30742749 |
ggtatgcttttggaaaaaagcatccaccaaatgaagtgaaatgatcgataaagatgctattaagctgccaactcaaacaat |
30742829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University