View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0152-INSERTION5 (Length: 420)

Name: NF0152-INSERTION5
Description: NF0152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0152-INSERTION5
NF0152-INSERTION5
[»] chr7 (2 HSPs)
chr7 (32-105)||(30742445-30742518)
chr7 (151-227)||(30742749-30742829)


Alignment Details
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 30742445 - 30742518
Alignment:
32 gcattcccttgtatgcagaaaactatgcttatcttttgggtcattttgatgcatcttcaattagctaacttaat 105  Q
    |||||| || |||| || ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
30742445 gcattcactagtattcaaaaagctatgcttatcttttgggtcattttgatgcatcttcaatcagctaacttaat 30742518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 227
Target Start/End: Original strand, 30742749 - 30742829
Alignment:
151 ggtatgcttttgaaagaaagaaaccaccaaat-aagtgagatgat---taaagatgctaataagctgccaactcaaacaat 227  Q
    |||||||||||| || |||| | ||||||||| |||||| |||||   ||||||||||| |||||||||||||||||||||    
30742749 ggtatgcttttggaaaaaagcatccaccaaatgaagtgaaatgatcgataaagatgctattaagctgccaactcaaacaat 30742829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 485 times since January 2019
Visitors: 2226