View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154-Insertion-16 (Length: 306)
Name: NF0154-Insertion-16
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154-Insertion-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 8 - 306
Target Start/End: Complemental strand, 7737683 - 7737385
Alignment:
| Q |
8 |
gaagtttcaacccacctatctaggtcggcacacatcattcgcctcgttttagacggattgattgcaagaaaggaaaaacggagacaggttgatcagtttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737683 |
gaagtttcaacccacctatctaggtcggcacacatcattcgcctcgttttagacggattgattgcaagaaaggaaaaacggagacaggttgatcagtttt |
7737584 |
T |
|
| Q |
108 |
tccatccctaatttcccttttaaatccttggaactcaagtaaagcttcataatcccttttaaagtaaatcatgttgaagaaattaaaatcatttggtatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737583 |
tccatccctaatttcccttttaaatccttggaactcaagtaaagcttcataatcccttttaaagtaaatcatgttgaagaaattaaaatcatttggtatt |
7737484 |
T |
|
| Q |
208 |
ttggtagactttaaagtaataggagaaaagattggattaaatacaaaagacnnnnnnnggtagttattgggtcaaaatcattagaacaactcatgtgag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7737483 |
ttggtagactttaaagtaataggagaaaagattggatcaaatacaaaagacaaaaaaaggtagttaatgggtcaaaatcattagaacaactcatgtgag |
7737385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6922 times since January 2019
Visitors: 9353