View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154-Insertion-18 (Length: 49)
Name: NF0154-Insertion-18
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154-Insertion-18 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 40340150 - 40340191
Alignment:
Q |
8 |
tatttatctagagctgccgtttgtttttcctttctttacatc |
49 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40340150 |
tatttatctagagctgccgtttgtttttcctttctttacatc |
40340191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University