View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_1D_low_11 (Length: 242)
Name: NF0154_1D_low_11
Description: NF0154_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_1D_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 7 - 156
Target Start/End: Original strand, 53788091 - 53788241
Alignment:
Q |
7 |
attccatctatctaggacttcgttaaattcatttgcaaatgcttgttgggaaaatcaactg-ttccattatttgagtatttgaataattttctttccaat |
105 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||| || ||||| |
|
|
T |
53788091 |
attccatctatccaggacttcgttaaattcatttgcaaatgcttgttgggaaaatcaaccggttccattatttgagtattgcaataatttttttcccaat |
53788190 |
T |
 |
Q |
106 |
atttaatcacttccagcatcttgattcaatttggcattctcttccattaca |
156 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
T |
53788191 |
atttaatcacttccagcatcttgattcaatttaacattctcttctattaca |
53788241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1964 times since January 2019
Visitors: 2201