View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_1D_low_17 (Length: 220)
Name: NF0154_1D_low_17
Description: NF0154_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_1D_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 100 - 210
Target Start/End: Complemental strand, 44407134 - 44407024
Alignment:
Q |
100 |
tgaaaaagccactaaattcagcaaaaaataacatcaatgccactggaactatcctatcctaaattttccagcaagagatggctttgccctgaatacatac |
199 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44407134 |
tgaaaatgccactaaattcagcaaaaaataacatcaatgccactggaactatcctatcctaaattttccagcaagagatggctttgccctgaatacatac |
44407035 |
T |
 |
Q |
200 |
atgttagtatt |
210 |
Q |
|
|
||||||||||| |
|
|
T |
44407034 |
atgttagtatt |
44407024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 7 - 111
Target Start/End: Complemental strand, 10637448 - 10637344
Alignment:
Q |
7 |
attatatgtttgctcaagttttcaccaagttaaattgcacgatgcatcatctaaagaaattgtgttttatatcgtcatcaaaattaaagttgttgaaaaa |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10637448 |
attatatgtttgctcaagttttcaccaagttaaattgcacgatgcatcatctaaataaattgtgttttatatcgtcatcaaaattaaagttgttgaaaaa |
10637349 |
T |
 |
Q |
107 |
gccac |
111 |
Q |
|
|
||||| |
|
|
T |
10637348 |
gccac |
10637344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University