View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_high_104 (Length: 294)

Name: NF0154_2D_high_104
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_high_104
NF0154_2D_high_104
[»] chr3 (1 HSPs)
chr3 (2-278)||(15807086-15807361)
[»] chr1 (1 HSPs)
chr1 (63-278)||(45929408-45929624)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 2 - 278
Target Start/End: Original strand, 15807086 - 15807361
Alignment:
2 ccaatctggtaatgattagtgtctcatggttgcaggaaggagagcttacagagaaacatactaaaagaagtgatgccaaggagctacagaattactacca 101  Q
    |||| |||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
15807086 ccaagctggtaattatgagtgtctcatggttgcaggaaggagagcttacagaaaaacatactaaaagaagtgatgccaaggagctacagaattactacca 15807185  T
102 atatttttacgagaaaagaatccgggatggtgaatttactaaaaaaccgtaaggcttgattgatcttactttaacttgctcttgcacattgtgtgaatca 201  Q
    |||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||    
15807186 atatttctacgagaagagaatccgggatggtgaatttacgaaaaaaccgtaaggcttgattgatcttacttaaacttgctcttgcacgttgtgtgaatca 15807285  T
202 agttattttacaattgtcttatcttctgatattacttctgtagggaggaaatggttaggaacgttcagattgcaact 278  Q
      | |||||||| || ||||||||||||||  |  || |||||||||||||||||||||||||||||||||||||||    
15807286 tatgattttacatttatcttatcttctgatgct-gttttgtagggaggaaatggttaggaacgttcagattgcaact 15807361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 63 - 278
Target Start/End: Original strand, 45929408 - 45929624
Alignment:
63 taaaagaagtgatgccaaggagctacagaattactaccaatatttttacgagaaaagaatccgggatggtgaatttactaaaaaaccgtaaggcttgatt 162  Q
    ||||||||||||||||||||||||||||| ||||||||||| ||| |||||||| ||||||| ||||||||||  |||||||||||| ||||||||||||    
45929408 taaaagaagtgatgccaaggagctacagagttactaccaatttttctacgagaagagaatccaggatggtgaaaatactaaaaaaccataaggcttgatt 45929507  T
163 gatcttactttaacttgctcttgcacattgtgtgaatcaagttattttacaattgtctta-tcttctgatattacttctgtagggaggaaatggttagga 261  Q
    |||||| ||| ||||||||||  ||  ||||||| ||||  | |||||| | |||||||| ||||||| | |  ||| || |||||||||||||||| ||    
45929508 gatcttgcttaaacttgctctctcatgttgtgtgtatcacatgattttatatttgtcttattcttctgttgtcgcttttgaagggaggaaatggttaaga 45929607  T
262 acgttcagattgcaact 278  Q
    | |||||||||||||||    
45929608 atgttcagattgcaact 45929624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2008 times since January 2019
Visitors: 2203