View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_106 (Length: 286)
Name: NF0154_2D_high_106
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_high_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 51403592 - 51403329
Alignment:
Q |
1 |
ccaaagtgaaatcaggggcgacgtgtcatcgccagataatgatatggctagagcgagaagtacccaggctgcaacatcattaacagcagctgctgacatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51403592 |
ccaaagtgaaatcaggggcgacgtgtcatcgccagataatgatatggctagagcaagaagtacccaggctgcaacatcattaacagcagctgctgacatt |
51403493 |
T |
 |
Q |
101 |
gctatacgaccaacatccgtggttagcagtttgagctcagctaggattcgagcgaggacgggaaatgctgtgattgagagagcaacacccatgaagacaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51403492 |
gctatacgaccaacatccgtggttagcagtttgagctcagctaggattcgagcgaggacgggaaatgctgtgattgagagagcaacacccatgaagacaa |
51403393 |
T |
 |
Q |
201 |
ggaaagggacaggttgtgcacctttggagattgtggctctaagaacaatggatgttcctatgcc |
264 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
51403392 |
ggaaagggacaggttgtgcacctttggagattgtggctctaagaacaacggatgttcctatgcc |
51403329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 50 - 204
Target Start/End: Original strand, 29983284 - 29983438
Alignment:
Q |
50 |
agagcgagaagtacccaggctgcaacatcattaacagcagctgctgacattgctatacgaccaacatccgtggttagcagtttgagctcagctaggattc |
149 |
Q |
|
|
||||| ||||||| ||| || || || ||||| |||||||| ||||||||||| || ||||||||||| || || || |||||||| ||||||||||||| |
|
|
T |
29983284 |
agagcaagaagtatccaagcagcgacgtcattgacagcagcagctgacattgccatccgaccaacatcggttgtgaggagtttgagttcagctaggattc |
29983383 |
T |
 |
Q |
150 |
gagcgaggacgggaaatgctgtgattgagagagcaacacccatgaagacaaggaa |
204 |
Q |
|
|
|||| ||||| ||||| |||||||| ||||||||||| |||||||| |||||||| |
|
|
T |
29983384 |
gagcaaggacaggaaaggctgtgatcgagagagcaacgcccatgaaaacaaggaa |
29983438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1777 times since January 2019
Visitors: 2197