View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_117 (Length: 254)
Name: NF0154_2D_high_117
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_117 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 10252055 - 10252276
Alignment:
| Q |
19 |
ctttgagtggctaaaagaaaggtggaccctttgcgcattaatgaattccaaagagaaatatcatgatttagttttatgcttcattttcaccacacatatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10252055 |
ctttgagtggctaaaagaaaggtggaccctttgcgcattaatggattccaaagagaaatatcatgatttagttttatgcttcattttcaccacacagatg |
10252154 |
T |
|
| Q |
119 |
cacccctctatgctattcatgatatggactactgaaaatatgatttgattctaaggtaaaacgtaatggagagagcacttagtttaagaggcaatataac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10252155 |
tacccctctatgctattcatgatatggactactgaaaatatgatttgattctaaggtaaaacgtaatggagagagcacttagtttaagaggcaatataac |
10252254 |
T |
|
| Q |
219 |
ttagtagcatagatcacaggtt |
240 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
10252255 |
ttagtagcatagatcaaaggtt |
10252276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1758 times since January 2019
Visitors: 2197