View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_119 (Length: 252)
Name: NF0154_2D_high_119
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_119 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 49066067 - 49065880
Alignment:
| Q |
20 |
gaaaaggatttcacaacatttcaagtgatgaacgtagcacatcttagttagcttaccggaatttcaacaagaatttatcaattcaaaaat---aacattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49066067 |
gaaaaggatttcacaacatttcaagtgatgaacgtagcacatcttagttagcttaccggaatttcaacaagaatttatcaattcaaaaataacaacattt |
49065968 |
T |
 |
| Q |
117 |
tttactaaag-nnnnnnnnntgggataagggagttcattaacagatcattaagagtcttgaacttcccttaaaaaagtttacacaata |
203 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065967 |
tttactaaagaaaaaaaaaattggataagggagttcattaactgatcattaagagtcttgaacttcccttaaaaaagtttacacaata |
49065880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University