View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_122 (Length: 245)
Name: NF0154_2D_high_122
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_high_122 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 72 - 226
Target Start/End: Original strand, 11035784 - 11035938
Alignment:
Q |
72 |
agcctcgaagaaaacacatccacatcagtagcaatcctatttccaacacacaagtaccataagagaaataaagatgatgctgttccagatggcgaaggcg |
171 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11035784 |
agcctcgaagaaaacacatccacatcagtagcaaacctatttccaacacacaagtaccataagagaaataaagatgatgctgttccagatggcgaaggcg |
11035883 |
T |
 |
Q |
172 |
acacgtgtgccgtgtgtttgggagattttgaggagggtgaagagttgaggactat |
226 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11035884 |
acacgtgtgccgtgtgtttgggagattttgaggagggtgaagagttgaggactat |
11035938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 86 - 226
Target Start/End: Original strand, 11034114 - 11034254
Alignment:
Q |
86 |
cacatccacatcagtagcaatcctatttccaacacacaagtaccataagagaaataaagatgatgctgttccagatggcgaaggcgacacgtgtgccgtg |
185 |
Q |
|
|
||||||| ||||| ||| || |||| ||||||||||||||||||| |||||||| |||| ||| | |||| |||||| |||||||| ||| ||||| ||| |
|
|
T |
11034114 |
cacatcctcatcaatagtaaacctaattccaacacacaagtaccacaagagaaacaaaggtgacgttgttacagatgacgaaggcggcacatgtgcggtg |
11034213 |
T |
 |
Q |
186 |
tgtttgggagattttgaggagggtgaagagttgaggactat |
226 |
Q |
|
|
|||||||||||||||||||| ||||| || ||||||||||| |
|
|
T |
11034214 |
tgtttgggagattttgaggaaggtgaggaattgaggactat |
11034254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1927 times since January 2019
Visitors: 2200