View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_high_150 (Length: 213)

Name: NF0154_2D_high_150
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_high_150
NF0154_2D_high_150
[»] chr5 (1 HSPs)
chr5 (151-204)||(12355218-12355271)


Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 12355218 - 12355271
Alignment:
151 caataaggtagacgacatagaaccacctattttctaccagattgttgatgtcca 204  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||| |||||    
12355218 caataaggtagacggcatagaaccacctattttctaccagattattgaagtcca 12355271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University