View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_158 (Length: 211)
Name: NF0154_2D_high_158
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_158 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 47 - 191
Target Start/End: Original strand, 7309865 - 7310009
Alignment:
| Q |
47 |
tccttcgtctccttcgagaatgatatgaagcttgattgttgttggaagcaagaagagcttttcgaaccgaaaaaaggagagtttgaaacttcattcggtg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309865 |
tccttcgtctccttcgagaatgatatgaagcttgattgttgttggaagcaagaagagcttttcgaaccgaaaaaaggagagtttgaaacttcattcggtg |
7309964 |
T |
 |
| Q |
147 |
ataactagagtaagttgaacggagatggtcgacgatatcatcagc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309965 |
ataactagagtaagttgaacggagatggtcgacgatatcatcagc |
7310009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University