View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_160 (Length: 209)
Name: NF0154_2D_high_160
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_160 |
 | |
|
| [»] chr6 (4 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 718285 - 718475
Alignment:
| Q |
19 |
cattcctggtgtcattgatatccacacaaaagtcctgtaaagggctgggatcaaaggcaaaggcacatgatgctaaggccaagaaggctgtcacaaacaa |
118 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
718285 |
cattcttggtgtcattgatagccacacaaaagtcttgtagagggctgggatcaaaggcaaaggcacatgatgctaaggccaagaaggctgtcacaaacaa |
718384 |
T |
|
| Q |
119 |
gtaagtagtcttcatgnnnnnnnnnagaaattttattcgtgtaatttgcttgtatatgtttatgtaagggtgatatatttcacaatgcaaa |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
718385 |
gtaagtagtcttcatgtttttttttagaaattttattcgtgtaatttgcttgtatatgtttatgtaaggatgatatatttcacaatgcaaa |
718475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 19 - 119
Target Start/End: Original strand, 702992 - 703092
Alignment:
| Q |
19 |
cattcctggtgtcattgatatccacacaaaagtcctgtaaagggctgggatcaaaggcaaaggcacatgatgctaaggccaagaaggctgtcacaaacaa |
118 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
702992 |
cattcttggtgtcattgatagccacacaaaagtcctgtaaagggctgggatcaaaggcaaaggcacaagatgctaaagctaagaaggctgtcacaaacaa |
703091 |
T |
|
| Q |
119 |
g |
119 |
Q |
| |
|
| |
|
|
| T |
703092 |
g |
703092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 19 - 119
Target Start/End: Complemental strand, 712446 - 712346
Alignment:
| Q |
19 |
cattcctggtgtcattgatatccacacaaaagtcctgtaaagggctgggatcaaaggcaaaggcacatgatgctaaggccaagaaggctgtcacaaacaa |
118 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
712446 |
cattcttggtgtcattgatagccacacaaaagtcctgtaaagggctgggatcaaaggcaaaggcacaagatgctaaagctaagaaggctgtcacaaacaa |
712347 |
T |
|
| Q |
119 |
g |
119 |
Q |
| |
|
| |
|
|
| T |
712346 |
g |
712346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 25 - 133
Target Start/End: Original strand, 711258 - 711366
Alignment:
| Q |
25 |
tggtgtcattgatatccacacaaaagtcctgtaaagggctgggatcaaaggcaaaggcacatgatgctaaggccaagaaggctgtcacaaacaagtaagt |
124 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| |||||| |||||||| ||||||||||| ||||| || || | ||||||||| | |||||||||| | |
|
|
| T |
711258 |
tggtgtcattgatagccacacaaaagtcttgtagagggctaggatcaaatgcaaaggcacaagatgccaatgctaggaaggctgtgaaaaacaagtaaat |
711357 |
T |
|
| Q |
125 |
agtcttcat |
133 |
Q |
| |
|
| ||||||| |
|
|
| T |
711358 |
actcttcat |
711366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1559 times since January 2019
Visitors: 2192