View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_164 (Length: 203)
Name: NF0154_2D_high_164
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_high_164 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 125 - 188
Target Start/End: Complemental strand, 15807033 - 15806970
Alignment:
Q |
125 |
ttaccttctcgagtttgtgcaacaggtaagtcttgaattgacgaacaccacgcccacttgatgt |
188 |
Q |
|
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15807033 |
ttaccttttcgagtttgtgcaataggtaagtcttgaattgacgaacaccacgcccacttgatgt |
15806970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 15807086 - 15807156
Alignment:
Q |
2 |
ccaatctggtaatgattagtgtctcatggttgcaggaaggagagcttacagagaaacatactaaaagaagt |
72 |
Q |
|
|
|||| |||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
15807086 |
ccaagctggtaattatgagtgtctcatggttgcaggaaggagagcttacagaaaaacatactaaaagaagt |
15807156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 66 - 175
Target Start/End: Complemental strand, 45927984 - 45927874
Alignment:
Q |
66 |
aagaagtaatgtaccatgttcaaaatattgaagaatagcgagaaata-aaactagtcagcttaccttctcgagtttgtgcaacaggtaagtcttgaattg |
164 |
Q |
|
|
||||||||| ||||| |||||||||||||||||| |||| |||| ||| || ||| ||||| | ||||||||||||||||||| ||||||||||| |
|
|
T |
45927984 |
aagaagtaacataccaccttcaaaatattgaagaattgcgataaattcaaattattcactttaccctttcgagtttgtgcaacaggttagtcttgaattc |
45927885 |
T |
 |
Q |
165 |
acgaacaccac |
175 |
Q |
|
|
||||||||||| |
|
|
T |
45927884 |
acgaacaccac |
45927874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1939 times since January 2019
Visitors: 2201