View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_30 (Length: 527)
Name: NF0154_2D_high_30
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 272 - 508
Target Start/End: Complemental strand, 27080009 - 27079773
Alignment:
| Q |
272 |
ctgaaaaattctcaaactatagagatcaagccaatgttggtgctgactcgtttagttcctatgctaaggactcaacgggtgggacccatgttgattttga |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27080009 |
ctgaaaaattctcaaactatagagatcaagccaatgtgggtgccgactcgtttacttcctatgctaaggactcaacgggtgggacccatgttgattttga |
27079910 |
T |
|
| Q |
372 |
taactatggtaaatcttttaacgaaggaaccgacagtttcaaagggtatgctaaaggtgctgatgcggatcataaggtaacattcaaaggttatggtgtt |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27079909 |
taactatggtaaatcttttaacgaaggaaccgacagtttcaaagggtatgctaaaggtgctgatgcggatcataagataacattcaaaggttatggtgtt |
27079810 |
T |
|
| Q |
472 |
aataacacgtttaaggattacgataaaaaaggtattt |
508 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27079809 |
aataacacgtttaaggattacgataaaaaaggtattt |
27079773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 27080461 - 27080307
Alignment:
| Q |
19 |
ccggcaatacagccggagctcagccggtcataacgatagtttcaccaactatgctctcgaaaccaatgttgcagatcagaatttcaacacttacggctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27080461 |
ccggcaatacagccggagctcagccggtcataacgacagtttcaccaactatgctctcgaaaccaatgttgcagatcagaatttcaacacttacggctct |
27080362 |
T |
|
| Q |
119 |
ggcgccgccggtggctccggcgatttcaaagcatatgctaaaggcaccaacgtgc |
173 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27080361 |
ggcgctgccggtggctccggcgatttcaaagcatatgctaaaggcaccaacgtgc |
27080307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 171 - 276
Target Start/End: Original strand, 27080029 - 27080134
Alignment:
| Q |
171 |
tgcataatttttgaaattttctgttggattattcatattaacaccgtaattaacaaacgtgtctttattacctgtaccttgatccgcataacttgaaaaa |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27080029 |
tgcataatttttgaaattttctgttggattattcatattaacaccgtaattaacaaacgtgtctttattacctgtaccttgatccgcataacttgaaaaa |
27080128 |
T |
|
| Q |
271 |
cctgaa |
276 |
Q |
| |
|
|||||| |
|
|
| T |
27080129 |
cctgaa |
27080134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1978 times since January 2019
Visitors: 2202