View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_40 (Length: 471)
Name: NF0154_2D_high_40
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 16 - 452
Target Start/End: Original strand, 40509937 - 40510373
Alignment:
Q |
16 |
tggtgttctctcttctacatattaagcttcatattgcaagatttgagtatcaggcattaactggtattctacggtgacattggttcgtggatgaaatttt |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40509937 |
tggtgttctctcttctacatattaagcttcatattgcaagatttgagtatcaggcattaattggtattctacggtgacattggttcgtggatgaaatttt |
40510036 |
T |
 |
Q |
116 |
cttttgagcatgtatagttgatgcgtcttagtttctgtaatctcgatttttcaatattataaatgcattannnnnnngtagtgctttctgactggcgtaa |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
40510037 |
cttttgagcatgtatagttgatgcgtcttagtttctgtaatctcgatttttcaatattataaatgcattatttttttgtagtgctttctgactggcgtaa |
40510136 |
T |
 |
Q |
216 |
aaggattccagtataagaaaaggacaacctacgagcttcaagcctatgtagatgacggtagccttatttctgaaatcctcattgatcatgatgtgagttt |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40510137 |
aaggattccagtataagaaaaggacaacctacgagcttcaagcctatgtagatgacggtagccttatttctgaaatcctcattgatcatgatgtgagttt |
40510236 |
T |
 |
Q |
316 |
gttctaaaaaataatcttttaaagcgtgaactttatctttttgcagtactaagatgatcaatgatataatattttaggttgtacagaaaggaattggtta |
415 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
40510237 |
gttctaaaaaataatcttttaaagcgtgagctttatctttttgccgtactaagatgatcaatgatataatatattaggttgtacagaaaggaattggtta |
40510336 |
T |
 |
Q |
416 |
ttctcccatggaggtcactgcggctctttcttcttct |
452 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
40510337 |
ttctcccatggaggtcactgcggctctttcttcttct |
40510373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2066 times since January 2019
Visitors: 2205