View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_55 (Length: 392)
Name: NF0154_2D_high_55
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 20 - 371
Target Start/End: Original strand, 42385293 - 42385635
Alignment:
| Q |
20 |
gatattacacaaacatagtctatgataagaagttacgataagagggaaatcgaggtgactattgaacaatcatattatttgtcatagctgacgggtatta |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42385293 |
gatattacacaaacatagtcgatgataagaagttacgataagagcgaaattgaggtgcctattgaacaatcatattatttgtcatagctgacgggtatta |
42385392 |
T |
 |
| Q |
120 |
gaaggctct--tgtggtggcattaacatagagatggttacaatgataatggtgtgtaacatcgacatttatgcaaatacactatcttttgcatatgtacc |
217 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42385393 |
gaaggctctgctgtggtggcattaacatggagaaggttacaatgataatggtgtgtaacatcgacatttatgcaaatacactatcttttgcatatg---- |
42385488 |
T |
 |
| Q |
218 |
ttagttatacctggttatacctcctcaaaggtagacagtccatatcctagttatacctggcttataaactgtgcagtggtgcaataggtatatgactagc |
317 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42385489 |
-------tacctagttatacctcctcaaaggtagacagtccatatcctagttatacctagcttataaactgtgcagtggtgcaataggtatatgactagc |
42385581 |
T |
 |
| Q |
318 |
tataccctatcggccagattattgggaagaaattatgagtatgtttgtggacta |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42385582 |
tataccctatcggccagattattgggaagaaattatgggtatgtttgtggacta |
42385635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University