View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_73 (Length: 356)
Name: NF0154_2D_high_73
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 28 - 339
Target Start/End: Original strand, 48555430 - 48555742
Alignment:
| Q |
28 |
gtatggagttgtgatggtaaaagtttaaaactttcttgcggcatatggacttgatctaaaagatgtcaagttgttaatgaattgtttaacagaacagtct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48555430 |
gtatggagttgtgatggtaaaagtttaaaactttcttggggcatatggacttgatctaaaagatgtcaagttgttaatgaattgtttaacagaacagtct |
48555529 |
T |
|
| Q |
128 |
aattttcannnnnnn-acgtcctctaaagaaattttttatgcaggtgttgcattttctaatattatgtgtcaaagttcaactttatacaaaggatttaca |
226 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48555530 |
aattttcattttttttacgtcctctaaagaaattttttatgcaggtgttgcattttgtaatattatgtgtcaaagttcaactttatacaaaggatttaca |
48555629 |
T |
|
| Q |
227 |
tactttcaagtaaagtaatacccatgttatataatgaaatccgtgtatgtatccacctattgctgannnnnnnnnncaaagaaaatatgaattatttaga |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48555630 |
tactttcaagtaaagtaatacccatgttatataatgaaatccgtgtatgtatccacctattgctgattttttttttcaaagaaaatatgaattatttaga |
48555729 |
T |
|
| Q |
327 |
cccatttattctt |
339 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48555730 |
cccatttattctt |
48555742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1512 times since January 2019
Visitors: 2192