View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_high_81 (Length: 338)

Name: NF0154_2D_high_81
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_high_81
NF0154_2D_high_81
[»] chr3 (1 HSPs)
chr3 (20-178)||(26915339-26915503)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 26915503 - 26915339
Alignment:
20 gtggtatgccatggagacgagtttatatcatccacgaatatgttgacatagacataatact------taccatattttttcaccaaacaaaactatatac 113  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||    
26915503 gtggtataccatggagacgagtttatatcatccacgaatatgttgacatagacataatactattacttaccatattttttcaccaaacaaaactatatac 26915404  T
114 ccaataataatacacttgtgaaagagagcaagagtacgatattatgaaatttgaacgtaattgta 178  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
26915403 ccaataataatacatttgtgaaagagagcaagagtacgatattatgaaatttgaacgtaattgta 26915339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University