View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_81 (Length: 338)
Name: NF0154_2D_high_81
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_high_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 26915503 - 26915339
Alignment:
Q |
20 |
gtggtatgccatggagacgagtttatatcatccacgaatatgttgacatagacataatact------taccatattttttcaccaaacaaaactatatac |
113 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
26915503 |
gtggtataccatggagacgagtttatatcatccacgaatatgttgacatagacataatactattacttaccatattttttcaccaaacaaaactatatac |
26915404 |
T |
 |
Q |
114 |
ccaataataatacacttgtgaaagagagcaagagtacgatattatgaaatttgaacgtaattgta |
178 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26915403 |
ccaataataatacatttgtgaaagagagcaagagtacgatattatgaaatttgaacgtaattgta |
26915339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2013 times since January 2019
Visitors: 2203