View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_84 (Length: 330)
Name: NF0154_2D_high_84
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_high_84 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 28759538 - 28759234
Alignment:
| Q |
1 |
atcatggaacatgtggggtggtggtggtaggagagaaaatgagaaagagcaagtttctgaatggggtgtttctttgaaagaatgtgaggtggtgaaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28759538 |
atcatggaacatgtggggtggtggtggtaggagagaaaatgagaaagagcaagtttctgaatggggtgtttctttgaaagaatgtgaggtggtgaaggaa |
28759439 |
T |
|
| Q |
101 |
aacaagaaggtttcatcgccatcgcataggaagtttggaaggaaaagagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28759438 |
aacaagaaggtttcatcgccatcgcataggaagtttggaaggaaaagagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttg |
28759339 |
T |
|
| Q |
201 |
tgccatctgatggtggtgattggtgttttctgtctggttctgaatctgatgattctgattggtctattgggtggttggagcctcttggttctgattttga |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28759338 |
ttccatctgatggtggtgattggtgttttctgtctggttctgaatctgatgactctgattggtctattgggtggctggagcctcttggttctgattttga |
28759239 |
T |
|
| Q |
301 |
aagca |
305 |
Q |
| |
|
||||| |
|
|
| T |
28759238 |
aagca |
28759234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 160 - 298
Target Start/End: Complemental strand, 13756748 - 13756613
Alignment:
| Q |
160 |
ggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaatctgatgattctgat |
259 |
Q |
| |
|
||||||||| | | |||||||||||||||||||||| || || ||||||||||||||| | | ||||| || || |||||||||||||| || ||| |
|
|
| T |
13756748 |
ggaagagaggagagttgatagagagtatgatgttgttttagtatcatctgatggtggtggtggttgttta---tcaggctctgaatctgatgactcagat |
13756652 |
T |
|
| Q |
260 |
tggtctattgggtggttggagcctcttggttctgatttt |
298 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
13756651 |
tggtctattgggtggttagagcctcatggttctgatttt |
13756613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 233 - 284
Target Start/End: Original strand, 27969538 - 27969589
Alignment:
| Q |
233 |
tctggttctgaatctgatgattctgattggtctattgggtggttggagcctc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
27969538 |
tctggttctgaatctgatgattctgattggtcaattggatggttggaacctc |
27969589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 46047109 - 46047065
Alignment:
| Q |
240 |
ctgaatctgatgattctgattggtctattgggtggttggagcctc |
284 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||||||| |
|
|
| T |
46047109 |
ctgaatctgttgcttctgattggtctattggctggttggagcctc |
46047065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1995 times since January 2019
Visitors: 2203