View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_86 (Length: 326)
Name: NF0154_2D_high_86
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_high_86 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 38466172 - 38465955
Alignment:
Q |
15 |
tggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgttagttagggtatgggcctatgatttatgggctgaaaaatggtgtttca |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38466172 |
tggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgttagttagggtatgggcctatgatttatgggctgaaaaatggtgtttca |
38466073 |
T |
 |
Q |
115 |
gcctaagcccagagaaaaatcgcaaaaaggttgctattaatcaaaggtcatgagtttgaatcttgactcgagagactagtctctgcagttgtgtgcagag |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
38466072 |
gcctaagcccagagaaaaatcgcaaaaaggttgctattaatcaaaggtcatgagtttgaatctcgactcgagagactagtctctgcagttgtgtgcagag |
38465973 |
T |
 |
Q |
215 |
atactcagtacatacaaa |
232 |
Q |
|
|
||||||||| |||||||| |
|
|
T |
38465972 |
atactcagttcatacaaa |
38465955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University