View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_high_98 (Length: 305)
Name: NF0154_2D_high_98
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_high_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 47705470 - 47705183
Alignment:
Q |
1 |
tccaagcaaagacccaaataatcgttctatacttgctttctttgctggaggggaacatggtatgattagaaagacattactagatcaatggaaaggaaaa |
100 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47705470 |
tccaagcaaagaatcaaataatcgttctatacttgctttctttgctggaggggaacatggtatgattagaaagacattactagatcaatggaaaggaaaa |
47705371 |
T |
 |
Q |
101 |
gataaagaagtactagtgtatgaatatcttccnnnnnnncttaagtactttaaactcatgggaaaaagcaagttttgcttgtgtccaagtggctatgaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47705370 |
gataaagaagtactagtgtatgaatatcttccaaaaaaacttaagtactttaaactcatgggaaaaagcaagttttgcttgtgtccaagtggctatgaag |
47705271 |
T |
 |
Q |
201 |
tagctagccctagacttgtggagtctataaacactggatgtgtccctgtgattgtttcggataactatcaattaccctttagtgatgt |
288 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47705270 |
tagctagccctagacttgtggagtctataaacactggatgtgtccctgtgattgtttcggataactatcaattaccctttagtgatgt |
47705183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 44629169 - 44629206
Alignment:
Q |
167 |
agcaagttttgcttgtgtccaagtggctatgaagtagc |
204 |
Q |
|
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
T |
44629169 |
agcaagttttgtttgtgtccaagtggttatgaagtagc |
44629206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University