View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_low_124 (Length: 375)

Name: NF0154_2D_low_124
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_low_124
NF0154_2D_low_124
[»] chr1 (2 HSPs)
chr1 (127-251)||(23029968-23030091)
chr1 (12-60)||(23030087-23030135)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 8e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 127 - 251
Target Start/End: Complemental strand, 23030091 - 23029968
Alignment:
127 agaaagctataaagctaagaacatatttaacacattagttttgttttacataaaagtcctatacaaaaagctaaattttatattagaaaaagtccaaaca 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||| |||||||||||||    
23030091 agaaagctataaagctaagaacatatttaacacattagttttgttttacataaaagtcatgtacaaaaagctcaattttatattag-aaaagtccaaaca 23029993  T
227 taagaagaatttcccaatttaacta 251  Q
    |||||||| ||| | ||||| ||||    
23029992 taagaagagttttctaatttgacta 23029968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 60
Target Start/End: Complemental strand, 23030135 - 23030087
Alignment:
12 tagtctttacgaattgcaaagttagatgttttttgtgactaaaaagaaa 60  Q
    ||||||||||||| ||  |||||| |||||||||||||||||| |||||    
23030135 tagtctttacgaactgttaagttacatgttttttgtgactaaacagaaa 23030087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University