View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_124 (Length: 375)
Name: NF0154_2D_low_124
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_124 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 8e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 127 - 251
Target Start/End: Complemental strand, 23030091 - 23029968
Alignment:
Q |
127 |
agaaagctataaagctaagaacatatttaacacattagttttgttttacataaaagtcctatacaaaaagctaaattttatattagaaaaagtccaaaca |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||| ||||||||||||| |
|
|
T |
23030091 |
agaaagctataaagctaagaacatatttaacacattagttttgttttacataaaagtcatgtacaaaaagctcaattttatattag-aaaagtccaaaca |
23029993 |
T |
 |
Q |
227 |
taagaagaatttcccaatttaacta |
251 |
Q |
|
|
|||||||| ||| | ||||| |||| |
|
|
T |
23029992 |
taagaagagttttctaatttgacta |
23029968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 60
Target Start/End: Complemental strand, 23030135 - 23030087
Alignment:
Q |
12 |
tagtctttacgaattgcaaagttagatgttttttgtgactaaaaagaaa |
60 |
Q |
|
|
||||||||||||| || |||||| |||||||||||||||||| ||||| |
|
|
T |
23030135 |
tagtctttacgaactgttaagttacatgttttttgtgactaaacagaaa |
23030087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1854 times since January 2019
Visitors: 2199