View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_150 (Length: 354)
Name: NF0154_2D_low_150
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_150 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 174 - 339
Target Start/End: Complemental strand, 53828235 - 53828070
Alignment:
| Q |
174 |
atatatctaatatgtgactttttaatacactcttttacgtttatcactattgactacaatgcgtggatataagattgtctcaaccaattttaaaacttag |
273 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53828235 |
atatatctaacatgtgactttttaatacactcttttacgtttatcactattgactacagtgcgtggatataagattgtctcaaccaattttaaaacttag |
53828136 |
T |
|
| Q |
274 |
agctaactctaagaatgaaacctttcttaaattgtaacatgccatctcataatttatgttgagtat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53828135 |
agctaactctaagaatgaaacctttcttaaattgtaacatgccatctcataatttatgttgagtat |
53828070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 23 - 182
Target Start/End: Complemental strand, 53829488 - 53829328
Alignment:
| Q |
23 |
gagttaagttaaagagtaacatcttagaaaattgatttatcaactgaagactgtccttacttaatctcannnnnnnnc-aggattcatacctcaaacttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
53829488 |
gagttaagttaaagagtaacatcttagaaaattgatttatcaaccgaagactgtccttacttaatctcattttttttccatgattcatacctcaaacttt |
53829389 |
T |
|
| Q |
122 |
gcaaaaattatgtattattcctatctactacgttgagacttaatctcatctaatatatcta |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
53829388 |
gcaaaaattatgtattattcctatctactacgataagacttaatctcatctaatatatcta |
53829328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1702 times since January 2019
Visitors: 2196