View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_165 (Length: 339)
Name: NF0154_2D_low_165
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_165 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 35 - 262
Target Start/End: Original strand, 32183007 - 32183234
Alignment:
| Q |
35 |
tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183007 |
tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct |
32183106 |
T |
|
| Q |
135 |
ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggtgaggcagggatattcttgtggcatctcacatgta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32183107 |
ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggcgaggcagggatattcttgtggcatctcacatgta |
32183206 |
T |
|
| Q |
235 |
tatgtcggcctcacttccggattttcta |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32183207 |
tatgtcggcctcacttccggattttcta |
32183234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 121 - 262
Target Start/End: Original strand, 15858910 - 15859052
Alignment:
| Q |
121 |
cagcagtgggtgctggttgtgggttgtt-gttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggtgaggcagggatattcttgt |
219 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
15858910 |
cagcagtgggtgctggttctggggtgtttgttttagggcctgttttggtggcttgtggtgaggctgcgcgttgtttgtggtaaggcagggatattcttgt |
15859009 |
T |
|
| Q |
220 |
ggcatctcacatgtatatgtcggcctcacttccggattttcta |
262 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15859010 |
ggaatctcacatgtatatgtcggcctcacttccggattttcta |
15859052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 39 - 74
Target Start/End: Original strand, 15858870 - 15858905
Alignment:
| Q |
39 |
tgtttctgcttttgttggatggtagcagattttttg |
74 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15858870 |
tgtttctgcttttgttggatggtagcaaattttttg |
15858905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 262
Target Start/End: Complemental strand, 38086625 - 38086592
Alignment:
| Q |
229 |
catgtatatgtcggcctcacttccggattttcta |
262 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
38086625 |
catgtatatgtcggcctcacttctggattttcta |
38086592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1564 times since January 2019
Visitors: 2193