View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_low_165 (Length: 339)

Name: NF0154_2D_low_165
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_low_165
NF0154_2D_low_165
[»] chr4 (1 HSPs)
chr4 (35-262)||(32183007-32183234)
[»] chr6 (2 HSPs)
chr6 (121-262)||(15858910-15859052)
chr6 (39-74)||(15858870-15858905)
[»] chr8 (1 HSPs)
chr8 (229-262)||(38086592-38086625)


Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 35 - 262
Target Start/End: Original strand, 32183007 - 32183234
Alignment:
35 tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32183007 tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct 32183106  T
135 ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggtgaggcagggatattcttgtggcatctcacatgta 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
32183107 ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggcgaggcagggatattcttgtggcatctcacatgta 32183206  T
235 tatgtcggcctcacttccggattttcta 262  Q
    ||||||||||||||||||||||||||||    
32183207 tatgtcggcctcacttccggattttcta 32183234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 121 - 262
Target Start/End: Original strand, 15858910 - 15859052
Alignment:
121 cagcagtgggtgctggttgtgggttgtt-gttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggtgaggcagggatattcttgt 219  Q
    |||||||||||||||||| |||| |||| |||  |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||    
15858910 cagcagtgggtgctggttctggggtgtttgttttagggcctgttttggtggcttgtggtgaggctgcgcgttgtttgtggtaaggcagggatattcttgt 15859009  T
220 ggcatctcacatgtatatgtcggcctcacttccggattttcta 262  Q
    || ||||||||||||||||||||||||||||||||||||||||    
15859010 ggaatctcacatgtatatgtcggcctcacttccggattttcta 15859052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 39 - 74
Target Start/End: Original strand, 15858870 - 15858905
Alignment:
39 tgtttctgcttttgttggatggtagcagattttttg 74  Q
    ||||||||||||||||||||||||||| ||||||||    
15858870 tgtttctgcttttgttggatggtagcaaattttttg 15858905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 262
Target Start/End: Complemental strand, 38086625 - 38086592
Alignment:
229 catgtatatgtcggcctcacttccggattttcta 262  Q
    ||||||||||||||||||||||| ||||||||||    
38086625 catgtatatgtcggcctcacttctggattttcta 38086592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University