View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_169 (Length: 335)
Name: NF0154_2D_low_169
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_169 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 13 - 328
Target Start/End: Original strand, 2918071 - 2918383
Alignment:
Q |
13 |
acatcactccaaattctctcactgnnnnnnnggttgtcatatagagttagaaaaatgtcaaatcattcactaacattatcaactaatagttttgcgacat |
112 |
Q |
|
|
||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2918071 |
acatcactccaaattctctaactgaaaaaaaggttgtcatatagagttaaaaaaatgtcaaatcattcactaacattatcaactaatagttttgcgacat |
2918170 |
T |
 |
Q |
113 |
ttcacaaaccggttcaaccaagataacataattaatcttatttggcaaaatatagcataataattgacacaattgattaatacatgcttaattattacat |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2918171 |
ttcacaaaccggttcaaccaagataacataattaatcttatttggcaaaatatagcataataattgacacaattgattaatacatgcttaattattacat |
2918270 |
T |
 |
Q |
213 |
atgctaatattatgnnnnnnnnacaaaacataatattgaaaataattattgtacggcaaataattaatttctgtggtccagacacaacttgtggatgaat |
312 |
Q |
|
|
||| |||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2918271 |
atgttaatattatgttttttttacaaaacataatattgaaaata---attgtacggcaactaattaatttctgtggtccagacacaacttgtggatgaat |
2918367 |
T |
 |
Q |
313 |
gacatcaaaaatattt |
328 |
Q |
|
|
|||||||||||||||| |
|
|
T |
2918368 |
gacatcaaaaatattt |
2918383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University