View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_183 (Length: 324)
Name: NF0154_2D_low_183
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_183 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 51461008 - 51461311
Alignment:
Q |
1 |
attgctaaacatttctatttggccgacaatagagtttttactctatcttgtagttgtaactgcttgtaggtagaaatgagacggataaatatacacatag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||| ||||||||||||| |
|
|
T |
51461008 |
attgctaaacatttctatttggccgacaatagagtttttactctatcttgtagttgaaactgcttgtatgtagaaatgagatggatgaatatacacatag |
51461107 |
T |
 |
Q |
101 |
ctattcaaccaaaggtttcatggggtggtccaagttcaagttttgtcgggattgtgcagatttaagtgtactgacatatgctcttctacaagagacaagt |
200 |
Q |
|
|
||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
51461108 |
ctattcaaccaaaagtttcattgggtggtccaagttcaagttttgccgggattgtgcaga-ttaagtgtactgacatatgctcttctacaagagtcaagt |
51461206 |
T |
 |
Q |
201 |
tgaagtttctttattaaatgcatcatttactatggtttacactgtgtttctgacatttgcattggcatacttattgttggaaaggcaatattgttgcgta |
300 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||||| ||||||| |||||||||| |||| |
|
|
T |
51461207 |
tgaagtttctttattaaatgcatcatttactttggtttacaatgtgtttctgacatttgcattgacatacttattgctggaaagtcaatattgttccgta |
51461306 |
T |
 |
Q |
301 |
ggatg |
305 |
Q |
|
|
||||| |
|
|
T |
51461307 |
ggatg |
51461311 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University