View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_low_191 (Length: 315)

Name: NF0154_2D_low_191
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_low_191
NF0154_2D_low_191
[»] chr1 (1 HSPs)
chr1 (36-297)||(48027326-48027587)


Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 36 - 297
Target Start/End: Original strand, 48027326 - 48027587
Alignment:
36 actactaacaaacaaccccatttccaactttctcttctctccactannnnnnntacccacaatgagttactacaaccaacaacaaccgcccgtcggcgtt 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||| ||||||||||||||||||    
48027326 actactaacaaacaaccccatttccaactttctcttctctccactaccccccctacccacaatgagttactacaaccaacagcaaccgcccgtcggcgtt 48027425  T
136 ccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacacttcaattcaactcttgcatgttaatttatcatcttgattcttgatct 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
48027426 ccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacactttaattcaactcttgcatgttaatttatcatcttgattcttgatct 48027525  T
236 ttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccggaga 297  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48027526 ttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccggaga 48027587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1420 times since January 2019
Visitors: 2192