View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_192 (Length: 315)
Name: NF0154_2D_low_192
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_192 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 36 - 297
Target Start/End: Original strand, 48027326 - 48027587
Alignment:
Q |
36 |
actactaacaaacaaccccatttccaactttctcttctctccactannnnnnntacccacaatgagttactacaaccaacaacaaccgcccgtcggcgtt |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
48027326 |
actactaacaaacaaccccatttccaactttctcttctctccactaccccccctacccacaatgagttactacaaccaacagcaaccgcccgtcggcgtt |
48027425 |
T |
 |
Q |
136 |
ccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacacttcaattcaactcttgcatgttaatttatcatcttgattcttgatct |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48027426 |
ccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacactttaattcaactcttgcatgttaatttatcatcttgattcttgatct |
48027525 |
T |
 |
Q |
236 |
ttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccggaga |
297 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48027526 |
ttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccggaga |
48027587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University