View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_195 (Length: 312)
Name: NF0154_2D_low_195
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_195 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 15 - 301
Target Start/End: Original strand, 5950630 - 5950916
Alignment:
Q |
15 |
ggacatcattgaaataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccatggtgccagcgatatccatttgatatgtcatcagctcta |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
5950630 |
ggacatcattgaaataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccagggtgccagcgatatccatttgatatgtcatcaactcta |
5950729 |
T |
 |
Q |
115 |
ttgactgcacccgacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtctggat |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
5950730 |
ttgactgcacccgacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtcttgat |
5950829 |
T |
 |
Q |
215 |
aactgttcgtcctatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaatttgtgatgtcca |
301 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5950830 |
aactgttcgtcctatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaatttgtgatgtcca |
5950916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University