View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_low_219 (Length: 286)

Name: NF0154_2D_low_219
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_low_219
NF0154_2D_low_219
[»] chr4 (2 HSPs)
chr4 (1-264)||(51403329-51403592)
chr4 (50-204)||(29983284-29983438)


Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 51403592 - 51403329
Alignment:
1 ccaaagtgaaatcaggggcgacgtgtcatcgccagataatgatatggctagagcgagaagtacccaggctgcaacatcattaacagcagctgctgacatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
51403592 ccaaagtgaaatcaggggcgacgtgtcatcgccagataatgatatggctagagcaagaagtacccaggctgcaacatcattaacagcagctgctgacatt 51403493  T
101 gctatacgaccaacatccgtggttagcagtttgagctcagctaggattcgagcgaggacgggaaatgctgtgattgagagagcaacacccatgaagacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51403492 gctatacgaccaacatccgtggttagcagtttgagctcagctaggattcgagcgaggacgggaaatgctgtgattgagagagcaacacccatgaagacaa 51403393  T
201 ggaaagggacaggttgtgcacctttggagattgtggctctaagaacaatggatgttcctatgcc 264  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
51403392 ggaaagggacaggttgtgcacctttggagattgtggctctaagaacaacggatgttcctatgcc 51403329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 50 - 204
Target Start/End: Original strand, 29983284 - 29983438
Alignment:
50 agagcgagaagtacccaggctgcaacatcattaacagcagctgctgacattgctatacgaccaacatccgtggttagcagtttgagctcagctaggattc 149  Q
    ||||| ||||||| ||| || || || ||||| |||||||| ||||||||||| || ||||||||||| || || || |||||||| |||||||||||||    
29983284 agagcaagaagtatccaagcagcgacgtcattgacagcagcagctgacattgccatccgaccaacatcggttgtgaggagtttgagttcagctaggattc 29983383  T
150 gagcgaggacgggaaatgctgtgattgagagagcaacacccatgaagacaaggaa 204  Q
    |||| ||||| ||||| |||||||| ||||||||||| |||||||| ||||||||    
29983384 gagcaaggacaggaaaggctgtgatcgagagagcaacgcccatgaaaacaaggaa 29983438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University